Review



frequency snp rs11871306  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Thermo Fisher frequency snp rs11871306
    Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort
    Frequency Snp Rs11871306, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/frequency+snp+rs11871306/Frequency+SNP+rs11871306/pmc08252032-81-3-22
    Average 90 stars, based on 1 article reviews
    frequency snp rs11871306 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis"

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

    Journal: Annals of Neurology

    doi: 10.1002/ana.26061

    Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort
    Figure Legend Snippet: Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort

    Techniques Used:

    Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.
    Figure Legend Snippet: Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.

    Techniques Used: Sequencing

    Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.
    Figure Legend Snippet: Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.

    Techniques Used:

    Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.
    Figure Legend Snippet: Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.

    Techniques Used:

    Related Articles

    TaqMan Assay:

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis
    Article Snippet: .. For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′). ..

    Sequencing:

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis
    Article Snippet: .. For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′). ..



    Similar Products

    frequency snp rs11871306  (Thermo Fisher)
    90
    Thermo Fisher frequency snp rs11871306
    Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort
    Frequency Snp Rs11871306, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/frequency+snp+rs11871306/Frequency+SNP+rs11871306/pmc08252032-81-3-22
    Average 90 stars, based on 1 article reviews
    frequency snp rs11871306 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort

    Journal: Annals of Neurology

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

    doi: 10.1002/ana.26061

    Figure Lengend Snippet: Independent ( r 2 < 0.1) Genomewide Significant Associations With Relapse Hazard in the Discovery Cohort

    Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

    Techniques:

    Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.

    Journal: Annals of Neurology

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

    doi: 10.1002/ana.26061

    Figure Lengend Snippet: Forest plot of meta‐analysis of rs11871306*C association with relapse hazard. The Cox proportional hazards model was fitted with genotypes obtained by direct genotyping: genotypes obtained through TaqMan genotyping and Sanger sequencing for the discovery cohort, and through genotyping array for the replication cohort. CI, confidence interval; HR, hazard ratio.

    Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

    Techniques: Sequencing

    Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.

    Journal: Annals of Neurology

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

    doi: 10.1002/ana.26061

    Figure Lengend Snippet: Regional association plot of chromosome 17q21.32 with lead single nucleotide polymorphism (SNP) rs11871306 demonstrating an association with relapse hazard. Association results (primary y‐axis) are shown for genetic variants with a minor allele frequency (MAF) ≥2% and imputation INFO metric ≥0.9, along with recombination rates (secondary y‐axis), for a 500 kb region (250 kb region flanking the lead SNP rs11871306 (chr17:44954984 (hg19)). Each dot represents the ‐log 10 p value from the survival analysis using the Cox proportional hazards model including baseline relapses before any immunomodulatory treatment. Genetic variants are colored according their linkage disequilibrium (LD; r 2 ) with the lead SNP using the 1,000 Genomes Phase III EUR superpopulation.

    Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

    Techniques:

    Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.

    Journal: Annals of Neurology

    Article Title: Genetic Variation in WNT9B Increases Relapse Hazard in Multiple Sclerosis

    doi: 10.1002/ana.26061

    Figure Lengend Snippet: Survival curves for time to relapse by rs11871306 genotype. (A) In the discovery cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers, with a median relapse‐free interval of 0.95 versus 2.22 years. (B) In the replication cohort, individuals carrying the rs11871306*C allele have a shorter time to relapse compared with noncarriers with a median relapse‐free interval of 0.59 versus 2.00 years. Dotted lines represent 95% confidence intervals.

    Article Snippet: For the low frequency SNP rs11871306, genotyping of imputed calls in the entire discovery cohort was validated using a TaqMan assay (C_1139290_10; Life Technologies) and Sanger sequencing (Forward primer: 5′‐GGGTTATGCACACTCACCCA‐3′, Reverse primer: 5′‐GCCAGGGCAAAAGCCTTAAC‐3′).

    Techniques: